OZ Biosciences Blog

Tuesday, June 27, 2017

Functional Genomic #siRNA #Screening of #Retinal Ganglion Cells using #NeuroMag #transfection reagent (#Magnetofection technology)

Enhanced Functional Genomic Screening Identifies Novel Mediators of Dual Leucine Zipper Kinase-Dependent Injury Signaling in Neurons


Derek S. Welsbie et al. Neuron, 2017.

Functional Genomic Screening of Retinal Ganglion Cells using NeuroMag transfection reagent (Magnetofection technology)


Summary
Dual leucine zipper kinase (DLK) has been implicated in cell death signaling secondary to axonal damage in retinal ganglion cells (RGCs) and other neurons. To better understand the pathway through which DLK acts, we developed enhanced functional genomic screens in primary RGCs, including use of arrayed, whole-genome, small interfering RNA libraries. Explaining why DLK inhibition is only partially protective, we identify leucine zipper kinase (LZK) as cooperating with DLK to activate downstream signaling and cell death in RGCs, including in a mouse model of optic nerve injury, and show that the same pathway is active in human stem cell-derived RGCs. Moreover, we identify four transcription factors, JUN, activating transcription factor 2 (ATF2), myocyte-specific enhancer factor 2A (MEF2A), and SRY-Box 11 (SOX11), as being the major downstream mediators through which DLK/LZK activation leads to RGC cell death. Increased understanding of the DLK pathway has implications for understanding and treating neurodegenerative diseases.

Transfection with siRNAs and sgRNAs
RGCs were transfected with siRNAs (0.5-50 nM) or sgRNAs (1-30 nM) by complexing RNA with NeuroMag (OZ Biosciences) in Optimem before adding to wells. RGCs were then reverse transfected overnight on a stationary magnet (OZ Biosciences). In the case of transfecting with multiple RNAs, different siRNAs or siRNA and sgRNA were complexed together in the same mixture of Optimem/Neuromag. For experiments in which the amount of siRNA/siPOOL is not indicated in the legend, 0.5 - 1 nM total was used. Protospacer sequences: Atf2 - gtcgactcggggtgaggtaa, Mef2a - gttgagcactacagacctca, Jun - gctctcggactggaggaacg,Sox11 - gcgagaagatcccgttcatc.

Transfection of small RNAs (siRNAs, siPOOLs or sgRNAs) was performed at the time of isolation, using NeuroMag magnetic nanoparticle (OZ Biosciences, Marseille).

No comments:

Post a Comment