OZ Biosciences Blog

Friday, July 7, 2017

Sucessfull #transduction of #crypt cells and #organoids with #Magnetofection

HMGA1 amplifies Wnt signalling and expands the intestinal stem cell compartment and Paneth cell niche


Lingling Xian et al. Nature Communications, 2017.

Efficient transduction of crypt cells and mouse organoids from isolated crypts of the proximal small intestine with ViroMag R/L magnetic nanoparticles


Abstract
High-mobility group A1 (Hmga1) chromatin remodelling proteins are enriched in intestinal stem cells (ISCs), although their function in this setting was unknown. Prior studies showed that Hmga1 drives hyperproliferation, aberrant crypt formation and polyposis in transgenic mice. Here we demonstrate that Hmga1 amplifies Wnt/β-catenin signalling to enhance self-renewal and expand the ISC compartment. Hmga1 upregulates genes encoding both Wnt agonist receptors and downstream Wnt effectors. Hmga1 also helps to ‘build’ an ISC niche by expanding the Paneth cell compartment and directly inducing Sox9, which is required for Paneth cell differentiation. In human intestine, HMGA1 and SOX9 are positively correlated, and both become upregulated in colorectal cancer. Our results define a unique role for Hmga1 in intestinal homeostasis by maintaining the stem cell pool and fostering terminal differentiation to establish an epithelial stem cell niche. This work also suggests that deregulated Hmga1perturbs this equilibrium during intestinal carcinogenesis.

Lentivirus and transduction
For all lentiviral transductions, we modified an established protocol65 using magnetic nanoparticles (ViroMag R/L, OZ Bioscience, Inc.) and a magnetic plate (ViroMag R/L, OZ Bioscience, Inc., catalogue number: MF10000) to transduce crypt cells and organoids. Organoid fragments were seeded with 150 μl transduction medium into 48-well plates. Virus was added with viroMag R/L solution for 15 min at room temperature (2,500–3,000 virus particles per cells) to cells. The cell culture plate was placed on the magnetic plate for 30–60 min in a 37 °C tissue culture incubator. Cells were then incubated overnight at 37 °C. Organoid fragments and transduction media were then transferred to a 1.5 ml tube for centrifugation at 900 g for 5 min. The supernatant was discarded and tubes containing the pellet was placed on ice for 5 min. Next, 120 μl of matrigel was added and the pellet was resuspended by pipetting slowly up and down. Drops (30 μl) of basement matrix–cell mixtures were seeded into a new 48-well plate and incubated at 37 °C for 5–15 min until the basement matrix solidified. Media (ENRWntNic)6 was then added to each well and placed into a tissue culture incubator. Common ENR media6 was used and changed every 2–3 days beginning 4–6 days after the transduction.

Efficient #transfection of #LNA (Locked Nucleic Acid) in #Primary #cortical and #hippocampal #neurons using #NeuroMag magnetofection reagent

Inhibition of the Schizophrenia-Associated MicroRNA miR-137 Disrupts Nrg1a Neurodevelopmental Signal Transduction

Kristen Therese Thomas et al. Cell Reports, 2017.

Efficient transfection of LNA (Locked Nucleic Acid) in Primary cortical and hippocampal neurons using NeuroMag magnetofection reagent


SUMMARY
Genomic studies have repeatedly associated variants
in the gene encoding the microRNA miR-137 
with increased schizophrenia risk. Bioinformatic predictions 
suggest that miR-137 regulates schizophrenia-
associated signaling pathways critical to 
neural development, but these predictions remain 
largely unvalidated. In the present study, we demonstrate 
that miR-137 regulates neuronal levels of 
p55g, PTEN, Akt2, GSK3b, mTOR, and rictor. All are 
key proteins within the PI3K-Akt-mTOR pathway 
and act downstream of neuregulin (Nrg)/ErbB and 
BDNF signaling. Inhibition of miR-137 ablates 
Nrg1a-induced increases in dendritic protein synthesis, 
phosphorylated S6, AMPA receptor subunits, 
and outgrowth. Inhibition of miR-137 also blocks 
mTORC1-dependent responses to BDNF, including 
increased mRNA translation and dendritic 
outgrowth, while leaving mTORC1-independent S6 
phosphorylation intact. We conclude that miR-137
regulates neuronal responses to Nrg1a and BDNF 
through convergent mechanisms, which might 
contribute to schizophrenia risk by altering neural 
development.

Transfections
For western blot experiments using LNA inhibitors, neurons were transfected on DIV11 or DIV12 with 75 nM LNA inhibitor (final concentration) by magnetofection using Neuromag (Oz Biosciences, NM50200) per manufacturer’s instructions, and neurons were lysed after 3 days (on DIV14 or DIV15, respectively).

Tuesday, June 27, 2017

Functional Genomic #siRNA #Screening of #Retinal Ganglion Cells using #NeuroMag #transfection reagent (#Magnetofection technology)

Enhanced Functional Genomic Screening Identifies Novel Mediators of Dual Leucine Zipper Kinase-Dependent Injury Signaling in Neurons


Derek S. Welsbie et al. Neuron, 2017.

Functional Genomic Screening of Retinal Ganglion Cells using NeuroMag transfection reagent (Magnetofection technology)


Summary
Dual leucine zipper kinase (DLK) has been implicated in cell death signaling secondary to axonal damage in retinal ganglion cells (RGCs) and other neurons. To better understand the pathway through which DLK acts, we developed enhanced functional genomic screens in primary RGCs, including use of arrayed, whole-genome, small interfering RNA libraries. Explaining why DLK inhibition is only partially protective, we identify leucine zipper kinase (LZK) as cooperating with DLK to activate downstream signaling and cell death in RGCs, including in a mouse model of optic nerve injury, and show that the same pathway is active in human stem cell-derived RGCs. Moreover, we identify four transcription factors, JUN, activating transcription factor 2 (ATF2), myocyte-specific enhancer factor 2A (MEF2A), and SRY-Box 11 (SOX11), as being the major downstream mediators through which DLK/LZK activation leads to RGC cell death. Increased understanding of the DLK pathway has implications for understanding and treating neurodegenerative diseases.

Transfection with siRNAs and sgRNAs
RGCs were transfected with siRNAs (0.5-50 nM) or sgRNAs (1-30 nM) by complexing RNA with NeuroMag (OZ Biosciences) in Optimem before adding to wells. RGCs were then reverse transfected overnight on a stationary magnet (OZ Biosciences). In the case of transfecting with multiple RNAs, different siRNAs or siRNA and sgRNA were complexed together in the same mixture of Optimem/Neuromag. For experiments in which the amount of siRNA/siPOOL is not indicated in the legend, 0.5 - 1 nM total was used. Protospacer sequences: Atf2 - gtcgactcggggtgaggtaa, Mef2a - gttgagcactacagacctca, Jun - gctctcggactggaggaacg,Sox11 - gcgagaagatcccgttcatc.

Transfection of small RNAs (siRNAs, siPOOLs or sgRNAs) was performed at the time of isolation, using NeuroMag magnetic nanoparticle (OZ Biosciences, Marseille).

Tuesday, April 25, 2017

Kidney-specific Csf2 #knockdown. #In vivo knockdown of gene expression achieved by transfecting #siRNA using the in vivo #Magnetofection kit

A heart–brain–kidney network controls adaptation to cardiac stress through tissue macrophage activation

  • Katsuhito Fujiu et al. Nature Medicine, 2017.

Abstract
Heart failure is a complex clinical syndrome characterized by insufficient cardiac function. In addition to abnormalities intrinsic to the heart, dysfunction of other organs and dysregulation of systemic factors greatly affect the development and consequences of heart failure. Here we show that the heart and kidneys function cooperatively in generating an adaptive response to cardiac pressure overload. In mice subjected to pressure overload in the heart, sympathetic nerve activation led to activation of renal collecting-duct (CD) epithelial cells. Cell–cell interactions among activated CD cells, tissue macrophages and endothelial cells within the kidney led to secretion of the cytokine CSF2, which in turn stimulated cardiac-resident Ly6Clo macrophages, which are essential for the myocardial adaptive response to pressure overload. The renal response to cardiac pressure overload was disrupted by renal sympathetic denervation, adrenergic b2-receptor blockade or CD-cell-specific deficiency of the transcription factor KLF5. Moreover, we identified amphiregulin as an essential cardioprotective mediator produced by cardiac Ly6Clo macrophages. Our results demonstrate a dynamic interplay between the heart, brain and kidneys that is necessary for adaptation to cardiac stress, and they highlight the homeostatic functions of tissue macrophages and the sympathetic nervous system.

Kidney-specific Csf2 knockdown. 
In vivo knockdown of Csf2 gene expression was achieved by transfecting siRNA using the in vivo Magnetofection kit (OZ Bioscience), according to the manufacturer’s instructions. In brief, 50 μg of synthesized siRNA targeting Csf2 (5′-CGGAUUUCAUAGACAGCCUUAUU-3′; 5′-UAAGGCUGUCUAUGAAAUCCGUU-3′) or its scrambled control (5′-GCCGAAACUAGAUCCAUUGTTUU-3′; 5′-AACAAUGGAUCUAGUUUCGGCUU-3′) were mixed with 200 μl of SilenceMag and incubated for 20 min at room temperature. During this incubation, 8-week-old male mice were anesthetized, and a single midline laparotomy was made to gain access to the kidneys. Cylinder magnets were then placed on both kidneys, after which the siRNA solution was injected into the tail vein and allowed to circulate for 20 min with the magnets in place. The next day, gene expression analysis or the TAC procedure was performed.

High yield of #recombinant protein expression in #293F cells via transient transfection with #Hype-5 reagent

Modulation of TMEM16A Channel Activity by the Von Willebrand Factor Type A (VWA) Domain of the Calcium-Activated Chloride Channel Regulator 1 (CLCA1)


Monica Sala-Rabanal et al. JBC 2017.


ABSTRACT
Calcium-activated chloride channels (CaCCs) are key players in transepithelial ion transport and fluid secretion, smooth muscle constriction, neuronal excitability, and cell proliferation. The CaCC regulator 1 (CLCA1) modulates the activity of the CaCC TMEM16A/Anoctamin 1 (ANO1) by directly engaging the channel at the cell surface, but the exact mechanism is unknown. Here, we demonstrate that the von Willebrand factor type A (VWA) domain within the cleaved CLCA1 Nterminal fragment is necessary and sufficient for this interaction. TMEM16A protein levels on the cell surface were increased in HEK293T cells transfected with CLCA1 constructs containing the VWA domain, and TMEM16A-like currents were activated. Similar currents were evoked in cells exposed to secreted VWA domain alone, and these currents were significantly knocked down by TMEM16A siRNA. VWA-dependent TMEM16A modulation was not modified by the S357N mutation, a VWA domain polymorphism associated with more severe meconium ileus in cystic fibrosis (CF) patients. VWA-activated currents were significantly reduced in the absence of extracellular Mg2+, and mutation of residues within the conserved metal ion-dependent adhesion site (MIDAS) motif impaired the ability of VWA to potentiate TMEM16A activity, suggesting that CLCA1-TMEM16A interactions are Mg2+- and MIDAS-dependent. Increase in TMEM16A activity occurred within minutes of exposure to CLCA1 or after a short treatment with nocodazole, consistent with the hypothesis that CLCA1 stabilizes TMEM16A at the cell surface by preventing its internalization. Our study hints at the therapeutic potential of the selective activation of TMEM16A by the CLCA1 VWA domain in loss-of-function chloride channelopathies, such as CF.



Recombinant Expression of CLCA1 VWA
The VWA domain of CLCA1 was expressed in 293F cells via transient transfection with Hype-5 (OZ Biosciences, San Diego, CA) at 1:1.5 ratio (μg DNA: μl Hype-5), using 1 μg of plasmid per 1 million cells. Media from supernatants were harvested after 72 h. Protein was purified from media supernatant using Ni-NTA superflow resin (Qiagen, Hilden, Germany) and eluted in 5 ml of buffer A containing 50 mM K2HPO4 (pH 8), 300mM NaCl and 250 mM imidazole. Purified CLCA1 VWA was dialyzed into buffer B containing 20 mM HEPES and 150 mM NaCl (pH7.4), and concentrated in a centrifuge concentrator to 1 mM, calculated from absorbance at 280 nm.

#Gene Silencing in #pancreas and #ovarian carcinoma with #Lullaby #siRNA transfection reagent

SNAT7 is the primary lysosomal glutamine exporter required for extracellular protein-dependent growth of cancer cells


Quentin Verdon et al. PNAS, 2017

Abstract
Lysosomes degrade cellular components sequestered by autophagy or extracellular material internalized by endocytosis and phagocytosis. The macromolecule building blocks released by lysosomal hydrolysis are then exported to the cytosol by lysosomal transporters, which remain undercharacterized. In this study, we designed an in situ assay of lysosomal amino acid export based on the transcription factor EB (TFEB), a master regulator of lysosomal biogenesis that detects lysosomal storage. This assay was used to screen candidate lysosomal transporters, leading to the identification of sodium-coupled neutral amino acid transporter 7 (SNAT7), encoded by the SLC38A7 gene, as a lysosomal transporter highly selective for glutamine and asparagine. Cell fractionation confirmed the lysosomal localization of SNAT7, and flux measurements confirmed its substrate selectivity and showed a strong activation by the lysosomal pH gradient. Interestingly, gene silencing or editing experiments revealed that SNAT7 is the primary permeation pathway for glutamine across the lysosomal membrane and it is required for growth of cancer cells in a low free-glutamine environment, when macropinocytosis and lysosomal degradation of extracellular proteins are used as an alternative source of amino acids. SNAT7 may, thus, represent a novel target for glutamine-related anticancer therapies.


Cell Culture and DNA Transfection. 
Human cell lines were used in accordance with the regulations and guidelines from the French Ministry of Higher Education and Research (CODECOH). HeLa, A2780, and Mia-PaCa2 cells were grown in DMEM supplemented with 10% FBS, 50 μg·mL−1 streptomycin, and 50 U·mL−1 penicillin (“complete medium”; all products from GIBCO). They were kept in a humidified atmosphere at 37 °C with 5% CO2. For CRISPR/Cas9 genome edition and rescue experiments, HeLa and Mia-PaCa2 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) and Lullaby (OzBiosciences), respectively, according to the manufacturers’ instructions.

Tuesday, November 15, 2016

Mouse bone marrow macrophages & #THP1 transfection with #DNA using #Magnetofection

PARP9 and PARP14 cross-regulate macrophage activation via STAT1 ADP-ribosylation

Nature Communications,
Oct 2016
Iwata and al.

Abstract
Despite the global impact of macrophage activation in vascular disease, the underlying mechanisms remain obscure. Here we show, with global proteomic analysis of macrophage cell lines treated with either IFNγ or IL-4, that PARP9 and PARP14 regulate macrophage activation. In primary macrophages, PARP9 and PARP14 have opposing roles in macrophage activation. PARP14 silencing induces pro-inflammatory genes and STAT1 phosphorylation in M(IFNγ) cells, whereas it suppresses anti-inflammatory gene expression and STAT6 phosphorylation in M(IL-4) cells. PARP9 silencing suppresses pro-inflammatory genes and STAT1 phosphorylation in M(IFNγ) cells. PARP14 induces ADP-ribosylation of STAT1, which is suppressed by PARP9. Mutations at these ADP-ribosylation sites lead to increased phosphorylation. Network analysis links PARP9–PARP14 with human coronary artery disease. PARP14 deficiency in haematopoietic cells accelerates the development and inflammatory burden of acute and chronic arterial lesions in mice. These findings suggest that PARP9 and PARP14 cross-regulate macrophage activation.


Construction and enforced expression of mutant STAT1
Human pcDNA-GFP-STAT1 was purchased from Addgene (Cambridge, MA, USA). Step-wise mutations (glutamic acid, E, to glutamine, Q) was introduced at the two ribosylation sites flanking the phosphorylation at Tyr701—E657 and E705—by recombinant PCR mutagenesis. Mutated constructs were verified by DNA sequencing. Mouse bone marrow macrophages were differentiated from bone marrow stromal cells using 10 ng ml−1 M-CSF for 12 days. pcDNA-GFP-STAT1 (WT) and the mutant pcDNA-GFP-STAT1 E657Q, E705Q, were transferred by Magnetofection (OzBiosciences, San Diego, CA, USA). HEK293 cells were transfected using Lipofectamine LTX (Invitrogen, USA). Twenty-four hours after transfection, cells were serum-starved (0.1% FBS) for 2 h and stimulated with IFNγ for 1 h (phospho-STAT1) or 24 h (mRNA expression of pro-inflammatory factors). The overexpressed STAT1 was immunoprecipitated using anti-GFP antibody, clone 9F9.F9 (1:1,000, ab1218, Abcam). STAT1 phosphorylation at Tyr 701 was detected by anti-phospho-STAT1 (Tyr701; 1:1,000, mAb #7649, Cell Signaling). Antibodies against STAT1 (ab3987, Abcam) and GFP (ab290, Abcam) served as loading controls. Transfection into THP-1 cells was performed using the magnetofection method described above.

Use of #Lullaby to safely transfect #siRNA and screen Malignant Rhabdoid Tumors

Dual Targeting of PDGFR and FGFR1 Displays Synergistic Efficacy in Malignant Rhabdoid Tumors


Cell, Oct 2016 
Wong et al.

Abstract
Malignant rhabdoid tumors (MRTs) are pediatric cancers characterized by a deficiency in the SWI/SNF subunit SMARCB1. Wong et al. show that MRTs display coactivation of PDGFR and FGFR1 and that dual blockade of these receptors induces apoptosis. These findings present therapeutic opportunities to exploit tyrosine kinase dependencies in cancers with SWI/SNF  deficiencies.

siRNA transfections were performed as follows, 2000 cells/well were reverse transfected in 96-well plates with SMARTpool siRNAs (Dharmacon) using Lullaby reagent (Oz Biosciences). Where indicated, cells were treated with vehicle or drug 24h post transfection. Apoptosis and cell viability were measured using Caspase 3/7 Glo and Cell Titre Glo (Promega), respectively, 72-96h post transfection according to manufacturer’s instructions and normalised to cells transfected with a non-targeting siRNA pool.

Wednesday, August 10, 2016

Use of HYPE-5 to produce viral E proteins which can confer in vivo protection against ZIKA virus

Structural Basis of Zika Virus-Specific Antibody Protection

Cell July 2016
Haiyan Zhao et al.

Abstract 
Zika virus (ZIKV) infection during pregnancy has emerged as a global public health problem because of its ability to cause severe congenital disease. Here, we developed six mouse monoclonal antibodies (mAbs) against ZIKV including four (ZV-48, ZV-54, ZV-64, and ZV-67) that were ZIKV specific and neutralized infection of African, Asian, and American strains to varying degrees. X-ray crystallographic and competition binding analyses of Fab fragments and scFvs defined three spatially distinct epitopes in DIII of the envelope protein corresponding to the lateral ridge (ZV-54 and ZV-67), C-C' loop (ZV-48 and ZV-64), and ABDE sheet (ZV-2) regions. In vivo passive transfer studies revealed protective activity of DIII-lateral ridge specific neutralizing mAbs in a mouse model of ZIKV infection. Our results suggest that DIII is targeted by multiple type-specific antibodies with distinct neutralizing activity, which provides a path for developing prophylactic antibodies for use in pregnancy or designing epitope-specific vaccines against ZIKV.

HYPE-5 Transfection Kit is dedicated to achieve High Yield Protein Expression in mammalian cells. This Kit has been designed for maximum recombinant protein expression in HEK293 and CHO cells growing in suspension. It is composed of the HYPE-5 transfection reagent (a Lipofection reagent) and HYPE-Blast reagent (improves protein production in CHO cells). The HYPE-5™ transfection kit is ideal for bioreactor, spinner or flasks.


Wednesday, June 29, 2016

Use of NeuroMag to effectively transfect primary cortical neurons and iPSC-derived neurons

The inhibition of TDP-43 mitochondrial localization blocks its neuronal toxicity

Nature Medecine, 2016
Wenzhang Wang et al.

Abstract 
Genetic mutations in TAR DNA-binding protein 43 (TARDBP, also known as TDP-43) cause amyotrophic lateral sclerosis (ALS), and an increase in the presence of TDP-43 (encoded by TARDBP) in the cytoplasm is a prominent histopathological feature of degenerating neurons in various neurodegenerative diseases. However, the molecular mechanisms by which TDP-43 contributes to ALS pathophysiology remain elusive. Here we have found that TDP-43 accumulates in the mitochondria of neurons in subjects with ALS or frontotemporal dementia (FTD). Disease-associated mutations increase TDP-43 mitochondrial localization. In mitochondria, wild-type (WT) and mutant TDP-43 preferentially bind mitochondria-transcribed messenger RNAs (mRNAs) encoding respiratory complex I subunits ND3 and ND6, impair their expression and specifically cause complex I disassembly. The suppression of TDP-43 mitochondrial localization abolishes WT and mutant TDP-43-induced mitochondrial dysfunction and neuronal loss, and improves phenotypes of transgenic mutant TDP-43 mice. Thus, our studies link TDP-43 toxicity directly to mitochondrial bioenergetics and propose the targeting of TDP-43 mitochondrial localization as a promising therapeutic approach for neurodegeneration.

Use of CombiMag to successfully improve the viral transduction efficiency in primary HSCs – LSK cells

p38a Activates Purine Metabolism to Initiate Hematopoietic Stem/Progenitor Cell Cycling in Response to Stress

Cell Stem Cell, 2016
D. Karigane et al

Abstract 
Hematopoietic stem cells (HSCs) maintain quiescence by activating specific metabolic pathways, including glycolysis. We do not yet have a clear understanding of how this metabolic activity changes during stress hematopoiesis, such as bone marrow transplantation. Here, we report a critical role for the p38MAPK family isoform p38α in initiating hematopoietic stem and progenitor cell (HSPC) proliferation during stress hematopoiesis in mice. We found that p38MAPK is immediately phosphorylated in HSPCs after a hematological stress, preceding increased HSPC cycling. Conditional deletion of p38α led to defective recovery from hematological stress and a delay in initiation of HSPC proliferation. Mechanistically, p38α signaling increases expression of inosine-5′-monophosphate dehydrogenase 2 in HSPCs, leading to altered levels of amino acids and purine-related metabolites and changes in cell-cycle progression in vitro and in vivo. Our studies have therefore uncovered a p38α-mediated pathway that alters HSPC metabolism to respond to stress and promote recovery.

Tuesday, June 28, 2016

NeuroMag is used to transfect DNA minicircles in Oligodendrocytes, Astrocytes and Neural Stem Cells

Part I: Minicircle vector technology limits DNA size restrictions on ex vivo gene delivery using nanoparticle vectors: Overcoming a translational barrier in neural stem cell therapy

AR Fernandes et al. 

Abstract
Genetically engineered neural stem cell (NSC) transplant populations offer key benefits in regenerative neurology, for release of therapeutic biomolecules in ex vivo gene therapy. NSCs are 'hard-to-transfect' but amenable to 'magnetofection'. Despite the high clinical potential of this approach, the low and transient transfection associated with the large size of therapeutic DNA constructs is a critical barrier to translation. We demonstrate for the first time that DNA minicircles (small DNA vectors encoding essential gene expression components but devoid of a bacterial backbone, thereby reducing construct size versus conventional plasmids) deployed with magnetofection achieve the highest, safe non-viral DNA transfection levels (up to 54%) reported so far for primary NSCs. Minicircle-functionalized magnetic nanoparticle (MNP)-mediated gene delivery also resulted in sustained gene expression for up to four weeks. All daughter cell types of engineered NSCs (neurons, astrocytes and oligodendrocytes) were transfected (in contrast to conventional plasmids which usually yield transfected astrocytes only), offering advantages for targeted cell engineering. In addition to enhancing MNP functionality as gene delivery vectors, minicircle technology provides key benefits from safety/scale up perspectives. Therefore, we consider the proof-of-concept of fusion of technologies used here offers high potential as a clinically translatable genetic modification strategy for cell therapy. 

NeuroMag Transfection Reagent is the first dedicated Magnetofection™ transfection reagent for neurons from 1 DIV to 21 DIV. It has proven to be extremely efficient in transfecting a large variety of primary neurons such as cortical, hippocampal, dorsal root ganglion and motor neurons with all types of nucleic acids. Moreover, high transfection efficiency was also achieved in primary astrocytes, oligodendrocyte precursors or neural stem cells as well as other cell lines (C6, B65, PC12, N2A...). Due to its unique properties, NeuroMag allows following transfected neurons during several days. 


Tuesday, June 7, 2016

HeLa, 293T and SH-SY5Y cells were transfected with DreamFect, Dogtor

Minor intron splicing is regulated by FUS and affected by ALS-associated FUS mutants

EMBO, 2016
Stefan Reber et al.

Abstract 
Fused in sarcoma (FUS) is a ubiquitously expressed RNA-binding protein proposed to function in various RNA metabolic pathways, including transcription regulation, pre-mRNA splicing, RNA transport and microRNA processing. Mutations in the FUS gene were identified in patients with amyotrophic lateral sclerosis (ALS), but the pathomechanisms by which these mutations cause ALS are not known. Here, we show that FUS interacts with the minor spliceosome constituent U11 snRNP, binds preferentially to minor introns and directly regulates their removal. Furthermore, a FUS knockout in neuroblastoma cells strongly disturbs the splicing of minor intron-containing mRNAs, among them mRNAs required for action potential transmission and for functional spinal motor units. Moreover, an ALS-associated FUS mutant that forms cytoplasmic aggregates inhibits splicing of minor introns by trapping U11 and U12
snRNAs in these aggregates. Collectively, our findings suggest a possible pathomechanism for ALS in which mutated FUS inhibits correct splicing of minor introns in mRNAs encoding proteins required for motor neuron survival.


Thursday, May 26, 2016

CRISPR Transfection reagents


With more than 10 years of expertise in the development of transfection reagents, OZBiosciences now offers a new range of tailored transfection solutions for CRISPR/Cas9 technology:

Ideal for co-transfection of pDNA/pDNA, pDNA/gRNA, pDNA/mRNA
Specifically designed for mRNA/gRNA transfection
Optimized for recombinant Cas9 protein or Cas9/gRNA RNP complexes delivery
the only magnetic viral transduction enhancer for CRISPR/Cas9 encoding viruses (adenovirus, lentivirus, retrovirus…)

Thursday, March 31, 2016

AdenoMag allows to use a lower viral dose to effectively increase the overall safety profile of suicide gene therapy against fibroid tumors



Objective: To study whether efficient transduction and subsequent elimination of fibroid tumor-initiating stem cells during debulking of tumor cells will aid in completely eradicating the tumor as well as decreasing the likelihood of recurrence.

Intervention(s): Magnetic nanoparticles (MNPs) complexed to adenovirus (Ad-GFP) or (Ad-LacZ) used to transfect differentiated human fibroid cells in vitro.


Main Outcome Measure(s): Rate of transduction and tumor growth inhibition.
Result(s): We have developed a localized nonsurgical adenovirus-based alternative for the treatment of uterine fibroids that combines viral-based gene delivery with nanotechnology for more efficient targeting. Magnetic nanoparticles complexed to adenovirus, in the presence of an external magnetic field, accelerate adenovirus transduction. We observed a statistically significant increase in
transduction efficiency among differentiated human fibroid cells at two different multiplicities of infection (MOI), 1 and 10, respectively, with MNPs as compared with adenovirus alone. Human fibroid stem cells transfected with Ad-LacZ expressed b-galactosidaze at a MOI of 1, 10, and 50 at 19%, 62%, and 90%, respectively, which were statistically significantly enhanced with
MNPs.


Conclusion(s): When applied with adenovirus herpes simplex thymidine kinase, magnetofection statistically significantly suppressed proliferation and induced apoptosis in both cell types. Through the use of magnetofection, we will prove that a lower viral dose will effectively increase the overall safety profile of suicide gene therapy against fibroid tumors. (Fertil Steril 2016;-:-–-. 2016 by American Society for Reproductive Medicine.)
 

The use of magnetofection (AdenoMag), allowed a lower viral dose to effectively increase the overall safety profile of suicide gene therapy against fibroid tumors” Fibroid Stem Cells were efficiently infected with Adenovirus at low MOI using AdenoMag